Sequencing Coding Region and in Silico Structural Analysis of Protein Hexon of HAdV-3 Causing Conjunctivitis in Vietnam

To date, HAdVs includes roughly 100 different types belonging to family Adenoviridae, genera Mastadenovirus, which are divided into 7 species represented by letters from A to G [1,2]. The capsid of HAdVs consists of 20 facets made up of 3 main proteins hexon, penton, and fiber. Therein, hexon constitutes the major part of virus coat protein with 12 homo-trimer hexon proteins per facet [3]. The faceted exterior of hexon introduces 7 hypervariable regions (HVRs) in loop-1 and loop-2 structures that consider characteristics for HAdVs genotyping [4,5].

Therefore, researching the structure of hexon protein is important to explore the immune adaptation and develop novel biological applications. Understandings about HAdVs have been worldwide employed in vaccine producing (development) [6] and cancer therapies [7,8]. In Vietnam, there was one research that used HVR-7 to classify different HAdV types associated with conjunctivitis; and HAdV-3 was one of the types circulating in Hanoi, Vietnam [9]. In this study, we focused on sequencing the coding region and analyzing the 3D structure of hexon protein of HAdV-3 isolated in Vietnam; and then, evaluating the consequences of amino acid substitutions to the life span and virulence of the virus.

pdf 9 trang Hương Yến 04/04/2025 4240 Free
Bạn đang xem tài liệu "Sequencing Coding Region and in Silico Structural Analysis of Protein Hexon of HAdV-3 Causing Conjunctivitis in Vietnam", để tải tài liệu gốc về máy hãy click vào nút Download ở trên.

File đính kèm:

  • pdfsequencing_coding_region_and_in_silico_structural_analysis_o.pdf

Nội dung text: Sequencing Coding Region and in Silico Structural Analysis of Protein Hexon of HAdV-3 Causing Conjunctivitis in Vietnam

  1. VNU Journal of Science: Natural Sciences and Technology, Vol. 37, No. 1 (2021) 45-53 Original Article Sequencing Coding Region and in Silico Structural Analysis of Protein Hexon of HAdV-3 Causing Conjunctivitis in Vietnam Nguyen Van Sang*, Nguyen Thi Thu Huyen, Le Tuan Anh VNU University of Science, 334 Nguyen Trai, Hanoi, Vietnam Received 22 April 2020 Revised 25 November 2020; Accepted 27 November 2020 Abstract: Human adenovirus (HAdVs) are responsible for about 65-90% of viral conjunctivitis. Understandings of HAdVs bring promises in prevention, treatments, and biological preparations. However, thorough researches on structural proteins of HAdVs are still limited in Vietnam. In this study, we have sequenced the entire coding gene of protein hexon from HAdV-3 causing conjunctivitis in Vietnam and compared with the reference sequence in NCBI database. We detected 42 DNA variants, of which, 11 resulted in amino acid substitutions. Simulation of HAdV- 3 hexon structure showed that all 11 substitutions located in crucial positions. This result revealed high risks from hexon gene variants of HAdV-3 enhancing its life span, virulence, and ability to avoid the host immune system. Keywords: Conjunctivitis, HAdV-3, Hexon structure 1. Introduction* with 12 homo-trimer hexon proteins per facet [3]. The faceted exterior of hexon introduces 7 To date, HAdVs includes roughly 100 hypervariable regions (HVRs) in loop-1 and different types belonging to family loop-2 structures that consider characteristics Adenoviridae, genera Mastadenovirus, which for HAdVs genotyping [4,5]. Therefore, are divided into 7 species represented by letters researching the structure of hexon protein is from A to G [1,2]. The capsid of HAdVs important to explore the immune adaptation and consists of 20 facets made up of 3 main proteins develop novel biological applications. hexon, penton, and fiber. Therein, hexon Understandings about HAdVs have been constitutes the major part of virus coat protein worldwide employed in vaccine producing (development) [6] and cancer therapies [7,8]. In ________ Vietnam, there was one research that used * Corresponding author. HVR-7 to classify different HAdV types Email address: [email protected] associated with conjunctivitis; and HAdV-3 45
  2. 46 N.V. Sang et al. / VNU Journal of Science: Natural Sciences and Technology, Vol. 37, No. 1 (2021) 45-53 was one of the types circulating in Hanoi, Isolation Kit manufactured by iNtRon company Vietnam [9]. In this study, we focused on (Korea). Viral DNA elution was stored at - sequencing the coding region and analyzing the 20oC, ready for PCR. Then, we amplified and 3D structure of hexon protein of HAdV-3 sequenced the HVR-7 region to detect the isolated in Vietnam; and then, evaluating the presence of HAdV-3 in the samples. The consequences of amino acid substitutions to the methods were described in more detail by Ha, life span and virulence of the virus. et al. [9]. 2.3 Designing primers for amplifying hexon 2. Materials and methods coding region 2.1 Collecting samples We collected and aligned the HAdV-3 genomes available in NCBI database to find the The eye-swabs of voluntary conjunctivitis conserved regions flanking hexon gene. The patients were collected at Vietnam National first primer pair HF1-HR1 was designed based Institute of Ophthalmology. The samples were o on the conserved regions. Then, like the primer kept in 1.5 ml tubes and stored at -20 C until walking technique, the second primer pair HF2- used for viral DNA extraction. HR2 was designed on 3’-terminator region of 2.2 Viral DNA extraction and detecting the the first sequences. Similarly, with primer pair presence of HAdV-3 HF3-HR3, we could obtain the full coding sequence of hexon gene of HAdV-3 (Table 1) The genome of HAdVs was purified by using Viral Gene-Spin Virus RNA/DNA Table 1. Sequence of primers used to amplify hexon gene of HAdV-3 in Vietnam Primers Sequence (5’-3’) Amplicon size (bp) HF1 CTTAATGACTGTTGACGCTG 4274 HR1 GGATCAAAAAGGTAGCAGGT HF2 CTCTGGTATTAACGGCGTAG 3131 HR2 GTATGGATAATTGGCTGGGT HF3 GCTTAACTTGCTTGTCTGTG 1878 HR3 TCTGAGGTCATTTCCAAGGG 2.4 PCR components and thermal cycles optimized for each primer pair and time for an extension of each reaction was calculated based All of the amplifying reactions were carried on the speed of polymerase as 30 seconds for out with enzyme Phusion Hotstart II DNA each 1 kb. All PCR products were checked by Polymerase (Thermo Scientific). Each 50 µl electrophoresis on 1% agarose gel at 90V, 30 PCR reaction mix contained 10 µl of GC buffer min. The gel was then dyed with ethidium (5X), 1.5 µl of each forward and reverse primer -1 bromide and the picture was captured by (10pmol µl ), 1 µl dNTPs mix (10 µM each), Alphaimager MINI system. 1.5 µl DMSO (100%), 0.5 ul enzyme (2 U/µl) and 1 µl of sample template. Amplifications 2.5 DNA sequencing included 30s initial denaturation at 98°C, PCR products with desired bands were sent followed by 40 cycles at 98°C (20 s), 60°C (10 st s), and 72°C (1-3 min), with a final extension at to 1 BASE company (Malaysia) and sequenced 72°C (5 min). Annealing temperature was
  3. N.V. Sang et al. / VNU Journal of Science: Natural Sciences and Technology, Vol. 37, No.1 (2021)45x-53 47 by BigDye® Terminator v3.1 cycle sequencing and data in Protein Data Bank (PDB). The kit. obtained structure was performed on pyMOL software [13]. 2.6 Analysis of DNA sequence Sequencing results were read and edited on 3. Results and discussion BioEdit program [10]. The coding sequence of hexon gene of HAdV-3 in Vietnam was aligned 3.1 PCR amplification of designed primer pairs with reference sequence NC_011203.1 by ClustalW program [11]. The length of hexon gene was 2835 bp. However, the amplicon obtained from PCR 2.7 Structural analysis of hexon protein with HF1-HR1 primers was 4274 bp long. The desired bands for PCR of HF2-HR2 and HF3- The DNA sequence was translated to amino HR3 primer pairs were 3131 bp and 1878 bp. acid sequence (1 letter code) in Snapgene The sequences of primers are described in software then align with 9 other hexon protein Table 1. The electrophoresis results in Figure 1 sequences from 7 different HAdV types. The showed that the desired bands were as bright as putative 3D structure of hexon of HAdV-3 in the marker and no undesired bands were Vietnam was constructed by Swiss-Model observed. Thus, the PCR products were used program [12], based on its amino acid sequence for sequencing reactions. HF1-HR1 HF2-HR2 HF3-HR3 10 kb 10 kb 8 kb 5 kb 8 kb 5 kb 4 kb 4274 3131 3 kb 4 kb 3 kb bp 3 kb bp 2 kb 1878 bp 2 kb 2 kb 1.5 kb 1.5 kb 1.5 kb 1.0 kb 1.0 kb 1.0 kb 750 bp 750 bp 750 bp 500 bp 500 bp 500 bp 250 bp 250 bp 250 bp Figure 1. The PCR-amplified products of hexon gene of HAdV-3 in Vietnam with respective primer pairs 3.2 Analysis of DNA sequence in Vietnam. The residual sequences were cut out in BioEdit program. All of the sequencing We obtained the full coding sequence of signals were well resolved with high and clear hexon gene of conjunctivitis-induced HAdV-3 peaks (Figure 2).
  4. 48 N.V. Sang et al. / VNU Journal of Science: Natural Sciences and Technology, Vol. 37, No. 1 (2021) 45-53 Figure 2. Signals of the first 60 nucleotides of hexon gene of HAdV-3 in Vietnam We aligned our sequence with the reference substitutions were observed to locate in sequence of HAdV-3 in the Genbank database hypervariable regions of hexon protein (HVR-1 (accession number: NC_011203) and detected to 7) [14, 15]. Meanwhile, no variants that 42 DNA variants scattering along hexon gene cause insertion, deletion, or frameshifts were (Table 2), in which, 11 DNA variants led to observed. amino acid substitutions. Nine out of 11 Table 2. DNA variants led to amino acid changes in hexon sequence of HAdV-3 in Vietnam Nucleotide Amino Acid Nucleotide Amino acid No Position No Position Seq1 Seq2 change Seq1 Seq2 changes 1 18489 C G - 22 20085 G A - 2 18542 G C G42A 23 20103 G A - 3 18594 C T - 24 20149 C A - 4 18834 A G - 25 20202 G A - 5 18838 G C G141R 26 20439 A G - 6 18840 G A - 27 20529 T C - 7 19313 A G E299G 28 20610 T C - 8 19321 A G N302D 29 20694 G A - 9 19380 C A - 30 20712 T C - 10 19395 C T - 31 20856 C T - 11 19648 A G N411D 32 20883 G A - 12 19670 C G 33 20892 A G - T418R 13 19671 A G 34 20964 G A - 14 19702 A G T429A 35 20970 C T - 15 19733 C A A439D 36 20976 G A - 16 19735 C A P440T 37 21012 T A - 17 19750 A G T445A 38 21015 C G - 18 19758 C A - 39 21042 G A -
  5. N.V. Sang et al. / VNU Journal of Science: Natural Sciences and Technology, Vol. 37, No.1 (2021)45x-53 49 19 19818 T C - 40 21051 C G - 20 19929 C T - 41 21067 A C M884L 21 19953 T C - 42 21084 A G - 1 Reference sequence of HAdV-3 (NC_011203) 2 The sequence of HAdV-3 sample in Vietnam “-” represented no changes of amino acid in this site 3.3 Analysis of protein structure Figure 3. Comparison of hexon protein sequences of HAdVs from different HAdV species Ten sequences of hexon protein were aligned by ClustalW method using BioEdit software. The result shows the 11 positions of amino acid changes in HAdV-3 VN (red arrow) which compared with type HAdV-3 (NC_01 1203). Most of them belong to HVR regions (no color). The prior researches showed evidence that activities in Vietnamese patients. Figure 3 the host immune system recognizes and showed that most of those substitutions belong terminates HAdVs through interactions with to HVR regions. Thus, we predict the 3D hexon [18, 19]; we assume, those 9 structure model of our amino acid sequence to substitutions on the HVR regions, have high study the meaning of changes for those chances of helping the virus avoid the immune substitutions.
  6. 50 N.V. Sang et al. / VNU Journal of Science: Natural Sciences and Technology, Vol. 37, No. 1 (2021) 45-53 A439D P440T T418R A T429A G141R E299G T445A N411D N302D M884L B G42A A439D T418R P440T T429A G141R o 180 HVR T445A regions E299G N411D L2 External L1 N302D Capsid side L4 L3 G42A Conserved Internal regions M884L Capsid side Figure 4. Structure of mono-hexon protein of HAdV-3 VN Side views of predicted 3D model of HAdV-3 VN mono-hexon protein based on the cryo-EM structure of HAdV-26 (PDB; 5TX1). (A) Cartoon structure of HAdV-3 VN with amino acid substitutions depicted on mono- hexon structure (sideview). (B) The protein surface was represented by 0.65 cartoon transparency. All structure models exposed 11 amino acid changes with highlight by sphere representation as G42A color hot pink, G141R color sand, E299G color lime, N302D color green, N411D color yellow, T418R color wheat, T429A color violet, A439D color red, P440T color cyan, T445A color purple, M884L color marine. L1-14 represent loop 1- loop 4 of hexon protein. The Swiss-Model program founds 22 3D model of hexon of HAdV-3 in Vietnam. In structural templates that can be used to build a which, 2OBE [16] has the highest identity to
  7. N.V. Sang et al. / VNU Journal of Science: Natural Sciences and Technology, Vol. 37, No.1 (2021)45x-53 51 our sequence (87.11%). However, 2OBE was would be more stable and solid. The last hexon of Chimpanzee Adenovirus and the substitution – G42A sited in the central region protein was described only in the monomer of each homo-trimer hexon where protein VI state. Therefore, we chose 5TX1 [17] as the clings to (protein VI plays a vital role in template to build the putative model for hexon cleaving precursor proteins) [20, 21]. Since a of HAdV-3 in Vietnam (identity 84.28%, neutral amino acid-like Glycine (G) was HAdV-26). All of 11 amino acid substitutions replaced by Alanine (A) – a hydrophobic amino were depicted on putative hexon structure in acid, we suppose the G42A substitution PyMOL software. Whereby, G42A and M884L affected the binding ability of protein VI to located on the inner side (conserved region) of hexon, stabilized interactions and enhanced the capsid while the other 9 substitutions were virulence of the virus. on the outer side (HVR regions) (Figure 4). Besides, our results showed that the regions Substitution M884L was found in the forming α helices and β sheets of hexon of interacting sites among hexon homo-trimers HAdV-3 in Vietnam were highly conserved. (Figure 5). Leucine (L) is highly hydrophobic This agrees with other researches showing that while Methionine (M) is significantly less hexon structures of different types: HAdV-26, hydrophobic, which might make bonds among HAdV-5, and HAdV-2 were almost identical, hexon homo-trimers stronger, thus the capsid except HVR regions [17, 22]. A B Figure 5. Homo-trimer hexon (view from inside) A. Substitutions G42A (pink) and M884L (orange). B. 12 homo-trimer hexon proteins make up a facet, M884L substitutions join at “star” signs. 4. Conclusions having potentials in helping the virus escaping the immune system. Meanwhile, two We successfully sequenced the coding substitutions (G42A and M884L) are region of hexon of HAdV-3 causing anticipated to enhance the vitality and virulence conjunctivitis in Vietnam. We detected 42 DNA of HAdV-3 in Vietnam. Lastly, the putative variants throughout the gene, in which, 31 were structure of hexon of HAdV-3 in Vietnam was silent mutations and 11 led to amino acid determined to be conserved with other HAdV substitutions. Nine substitutions were types in the world. determined to locate on HVRs of the capsid,
  8. 52 N.V. Sang et al. / VNU Journal of Science: Natural Sciences and Technology, Vol. 37, No. 1 (2021) 45-53 Acknowledgments [9] N. V. Ha, N. T. T. Huyen, D. T. T. Huyen, N. Q. Hung, T. T. Anh, H. A. Tuan, N. V. Sang, This research is funded by the Vietnam Method Development for Detection and National University, Hanoi (VNU) under Classification of Conjunctivitis-Causing project number QG.17.19 Adenoviruses in Human, VNU Journal of Science: Natural Sciences and Technology. 32 (2016) References [10] T. A. Hall, BioEdit : a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT, Nucleic Acids Symp. [1] D. Seto, J. Chodosh, J. R. Brister, M. S. Jones, C. Ser. 41 (1999) 95-98. Members of the Adenovirus Research, Using the [11] J. D. Thompson, D. G. Higgins, T. J. Gibson, whole-genome sequence to characterize and name CLUSTAL W: improving the sensitivity of human adenoviruses, Journal of virology. 85 progressive multiple sequence alignment through (2011) 5701-5702. sequence weighting, position-specific gap 354-11. penalties and weight matrix choice, Nucleic Acids [2] D. Seto, J. R. Brister, J. Chodosh, D. T. Curiel, A. Research. 22 (1994) 4673-4680. Heim, M. S. Jones, A. Kajon, T. Lion, Q. Zhang, 0.1093/nar/22.22.4673. Human-Adenovirus-Working-Group. [12] A. Waterhouse, M. Bertoni, S. Bienert, G. Studer, July, 2019. G. Tauriello, R. Gumienny, F. T. Heer, T. A. P. [3] W. Chiu, R. M. Burnett, R. L. Garcea, Structural de Beer, C. Rempfer, L. Bordoli, R. Lepore, T. biology of viruses, Oxford University Press, New Schwede, SWISS-MODEL: homology modelling York, 1997. of protein structures and complexes, Nucleic id=KUgQAQAAMAAJ. Acids Research. 46 (2018) W296-W303. [4] L. K. Crawford-Miksza, D. P. Schnurr, Adenovirus Serotype Evolution Is Driven by Illegitimate Recombination in the Hypervariable [13] W. L. DeLano, The PyMOL Molecular Graphics Regions of the Hexon Protein, Virology. 224 System, Educationnal Version Schrödinger, LLC, (1996) 357-367. (2002) .0543. [14] L. Crawford-Miksza, D. P. Schnurr, Analysis of [5] J. G. D. Gall, R. G. Crystal, E. Falck-Pedersen, 15 adenovirus hexon proteins reveals the location Construction and Characterization of Hexon- and structure of seven hypervariable regions Chimeric Adenoviruses: Specification of containing serotype-specific residues, Journal of Adenovirus Serotype, Journal of Virology. 72 Virology. 70 (1996) 1836-1844. (1998) 10260. /10.1128/JVI.70.3.1836-1844.1996. 0260-10264.1998. [15] J. Rux, R. Burnett, Type-Specific Epitope [6] C. Deal, A. Pekosz, G. Ketner, Prospects for oral Locations Revealed by X-Ray Crystallographic replicating adenovirus-vectored vaccines, Study of Adenovirus Type 5 Hexon, Molecular Vaccine. 31 (2013) 3236-3243. therapy : the journal of the American Society of .1016/j.Vaccine.2013.05.016. Gene Therapy. 1 (2000) 18-30. [7] S. Pesonen, L. Kangasniemi, A. Hemminki, Oncolytic Adenoviruses for the Treatment of [16] S. L. Pichla-Gollon, M. Drinker, X. Zhou, F. Xue, Human Cancer: Focus on Translational and J. J. Rux, G.-P. Gao, J. M. Wilson, H. C. J. Ertl, Clinical Data, Molecular Pharmaceutics. 8 (2011) R. M. Burnett, J. M. Bergelson, Structure-based 12-28. identification of a major neutralizing site in an [8] M. Schmid, P. Ernst, A. Honegger, M. adenovirus hexon, Journal of virology. 81 (2007) Suomalainen, M. Zimmermann, L. Braun, S. 1680-1689. Stauffer, C. Thom, B. Dreier, M. Eibauer, A. [17] X. Yu, D. Veesler, M. G. Campbell, M. E. Barry, Kipar, V. Vogel, U. F. Greber, O. Medalia, A. F. J. Asturias, M. A. Barry, V. S. Reddy, Cryo- Plückthun, Adenoviral vector with shield and EM structure of human adenovirus D26 reveals adapter increases tumor specificity and escapes the conservation of structural organization among liver and immune control, Nature human adenoviruses, Science Advances. 3 (2017) Communications. 9 (2018) 450. /10.1038/s41467-017-02707-6. [18] S. Roy, P. S. Shirley, A. McClelland, M. Kaleko, Circumvention of immunity to the adenovirus
  9. N.V. Sang et al. / VNU Journal of Science: Natural Sciences and Technology, Vol. 37, No.1 (2021)45x-53 53 major coat protein hexon, Journal of Virology. 72 [21] C. M. Wiethoff, H. Wodrich, L. Gerace, G. R. (1998) 6875-6879. Nemerow, Adenovirus protein VI mediates 2.8.6875-6879.1998. membrane disruption following capsid [19] C. Wohlfart, Neutralization of adenoviruses: disassembly, Journal of Virology. 79 (2005) kinetics, stoichiometry, and mechanisms, Journal 1992-2000. of Virology. 62 (1988) 2321-2328. 92-2000.2005. [20] H. Liu, L. Jin, S. B. S. Koh, I. Atanasov, S. [22] J. J. Rux, P. R. Kuser, R. M. Burnett, Structural Schein, L. Wu, Z. H. Zhou, Atomic structure of and Phylogenetic Analysis of Adenovirus Hexons human adenovirus by cryo-EM reveals by Use of High-Resolution X-Ray interactions among protein networks, Science Crystallographic, Molecular Modeling, and (New York, N.Y.). 329 (2010) 1038-1043. Sequence-Based Methods, Journal of Virology. 77 (2003) 9553. .77.17.9553-9566.2003.